In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

نویسندگان

  • J.A. Khan
  • R.S. Rathore
  • S. Khan
  • I. Ahmad
چکیده

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 μL and 50 μL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Isolation of Listeria monocytogenes from Meat and Dairy Products

Introduction: This study was intended to determine the presence and distribution of Listeria monocytogenes in various meat and dairy products from Qazvin Province by culture followed by biochemical and morphological assays. The identity of the isolates was further obtained by amplification of prfA gene in bacteria isolates. This gene is a transcriptional activator of virulence gene ex...

متن کامل

Rapid quantitative detection of Listeria monocytogenes in chicken using direct and combined enrichment/qPCR method

Listeria monocytogenes is a species of foodborne pathogen often related to foods, such as poultry, ready-to-eat products, fruits, and vegetables. The culture method is a standard procedure for the detection of bacteria in food products. The real-time quantitative PCR (qPCR) technique can be used for the quantification of foodborne pathogens. The current research was aimed to assess...

متن کامل

The investigation of molecular characterization of presumptive Listeria monocytogenes isolates from a food-processing environment

Background: Listeria is a Gram-positive, non-spore forming, facultative anaerobic intracellular bacterium. The most important pathogens in mammals include Listeria monocytogenes and Listeria ivanovii. The former generally causes disease and death in both humans and animals while the latter performs sporadically and primarily causes illness in ruminant...

متن کامل

Rational evaluation of antimicrobial properties of lactobacilli isolates against some pathogenic microorganisms: a new method comparing the susceptibility of indicator microorganisms

BACKGROUND: Lactobacilli are known as a valuable sourceof antimicrobial compounds and have a high potential of use infood biopreservation against food related microorganisms.OBJECTIVES: Antimicrobial potency of 63 dairy lactobacilliisolates against four highly important food-related microorganismswere evaluated. In addition, a new way in data organization wasintroduced, which led to a more info...

متن کامل

Increased detection of Listeria species and Listeria monocytogenes in raw beef, using the Assurance GDS molecular detection system with culture isolation.

Testing for Listeria is challenging because of its slow growth rate. Recently, we described a rapid Listeria culture isolation method. This method can be improved by utilizing a rapid molecular detection test such as the Assurance GDS tests for Listeria and Listeria monocytogenes. These two methods (culture isolation and Assurance GDS) use different enrichment strategies that may affect the num...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:

دوره 44  شماره 

صفحات  -

تاریخ انتشار 2013